Search results
Jump to navigation
Jump to search
Page title matches
- Op Gorilla Warfare 1 (OGW1) might well be the final massive material killing spree we are taking == Round 1: ==6 KB (925 words) - 08:58, 8 December 2015
- ...eriment. For more details, please refer to the [[Nitrification in Aquarium 1 (Lab Journal)|detailed lab journal]] of this experiment. ...fyers culture on July 22nd, 2015, by mixing 2.5 l of pond water (including 1 l of water from the bottom of the pond + soil) with tap water, to reach a t6 KB (1,025 words) - 13:08, 7 March 2017
- ...For a structured summary, please refer to the [[Nitrification in Aquarium 1 (Report)|report]] of the experiment. We started the nitrifyers culture by mixing 2.5 l of pond water (including 1 l of water from the bottom of the pond + soil) with tap water, to reach a t12 KB (1,914 words) - 10:26, 4 January 2016
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==5 KB (732 words) - 16:11, 27 January 2022
- ...[https://us04web.zoom.us/j/72462608438?pwd=TvLOA40iYQ66tcZlqtutetqif12IIV.1 via zoom])<br> (Rachel, 1 min)4 KB (584 words) - 19:29, 10 January 2024
Page text matches
- (Rachel, 1 min) (Rachel, 1 min)526 bytes (79 words) - 14:33, 25 August 2018
- (Rachel, 1 min) (Rachel, 1 min)545 bytes (81 words) - 12:19, 21 September 2018
- (Rachel, 1 min) (Rachel, 1 min)635 bytes (98 words) - 08:33, 21 November 2018
- To Make 1 Liter: 20 grams Agar. Cut into 1/2" pieces.1 KB (182 words) - 11:42, 9 June 2016
- ...EPFL 1st year students have basic biotech knowledge (biology is taught for 1 semester to all sections). == Day 1 ==901 bytes (122 words) - 22:43, 6 May 2015
- #REDIRECT [[Nitrification in Aquarium 1 (Report)]]50 bytes (5 words) - 12:10, 28 December 2015
- == Octanis 1 ==896 bytes (113 words) - 21:33, 1 September 2015
- #REDIRECT [[Nitrification in Aquarium 1 (Lab Journal)]]55 bytes (6 words) - 12:10, 28 December 2015
- ...lse}-->1<!--{/if}-->&wkst=<!--{$weekstart|escape:'urlpathinfo'|default:1}-->&hl=<!--{$lang|escape:'urlpathinfo'|default:en}-->&mode=<!--{$vi3 KB (482 words) - 09:58, 11 July 2016
- == Run / prototype #1== [[File:sketch-of-cool-exp-E1.JPG|300px|thumb|right|set up for run 1]]2 KB (271 words) - 09:39, 10 August 2015
- (Rachel, 1 min) ==Point 1: Demande 'utilité public'==2 KB (235 words) - 09:00, 21 January 2021
- ...per is dried. Meanwhile, the substance to be tested is mixed with a 0.1 to 1% solution of sodium hydroxide and let stand for a period of time. The prepa831 bytes (137 words) - 15:20, 11 December 2017
- ::1) Medium plates (with and without cultures) Should be labeled with: Name, da ::3) Things found unlabeled will be thrown away after 1 month. (Yeah I'm not such a maniac)771 bytes (132 words) - 12:44, 18 August 2015
- (Rachel, 1 min) ==Point 1: Demande 'utilité public'==2 KB (234 words) - 09:06, 5 November 2020
- Qty : 1 pc, Unit price : US$79<br> Shipping charge : US$45 by EMS for qty 1-10 pcs ( ~7-10 days delivery time from HK to Switzerland)<br>884 bytes (152 words) - 16:48, 18 August 2016
- File:Micro1.jpg| Olympus 1 File:Micro2.jpg| Olympus 1978 bytes (157 words) - 08:05, 2 December 2016
- == PLAY 1: How to connect an LED to a Raspberry Pi (or Arduino) ==1 KB (153 words) - 13:36, 6 March 2016
- ...://soundcloud.com/shalf/hackuarium-sur-la-route-1 Hackuarium Sur La Route #1, Soundcloud, 31.12.2014].365 bytes (51 words) - 09:59, 11 August 2015
- (Rachel, 1 min) (Rachel, 1 min)2 KB (296 words) - 12:03, 29 November 2018
- Point 0: public minutes (Rachel, 1 min) =Point 1: Demande d'être réconnu d'utilité publique=1 KB (152 words) - 14:54, 26 October 2021
- *10:00 AM visit to UniverCité. Where we work. - You will wander on a 1,000 sqm open space hosting a bio-laboratory, a co-working space, a maker-sp *1:00 Bioinformatic priming [https://prezi.com/z5bswnii1jcg/beerdecoded-workch2 KB (285 words) - 10:31, 5 February 2016
- (Rachel, 1 min) ==Point 1: Statutes & Extraordinary General Assembly==2 KB (315 words) - 13:42, 4 September 2020
- The standard 10+10 protocol was followed, and initially run only 1.5h at 63oC. ...with the first set of tubes always at 4 oC versus and another tube strip (1) from the RT batch were made with samples as as follows:5 KB (778 words) - 14:19, 14 September 2022
- 1. Einführung391 bytes (55 words) - 16:44, 14 March 2023
- LS-1 is a Tungsten Halogen Light Source # Plug the 12 V output end of the power supply into the back of the LS-1.2 KB (383 words) - 15:22, 17 July 2015
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==2 KB (348 words) - 13:08, 19 August 2021
- 1. Introduction395 bytes (62 words) - 16:38, 14 March 2023
- (Luc, 1 min) ==Point 1==3 KB (452 words) - 15:25, 12 March 2018
- (Rachel, 1 min) =Point 1: Updates Finance=2 KB (259 words) - 18:11, 18 December 2019
- Made 2 big Nunc freezing tubes with each combination, 1/2 E coli culture and 1/2 milk or glycerol. <br> Did another round of plate streaking on 22nov17 with both '1' vials - glycerol vs milk stock test.<br>2 KB (354 words) - 17:09, 24 November 2017
- 1, with 100ul of culture (full lawn) ...or this validation experiment were run: full strength bleach, for plate 1, 1/10 bleach in water for plate 2, and water only for plate 3, with the least6 KB (916 words) - 22:24, 15 December 2023
- ::1) The mode button can be set to "on" to permanently shake & "touch" to shake435 bytes (66 words) - 19:11, 8 July 2015
- Op Gorilla Warfare 1 (OGW1) might well be the final massive material killing spree we are taking == Round 1: ==6 KB (925 words) - 08:58, 8 December 2015
- -1-''Assemblée générale'' 1 Assemblée générale1 KB (202 words) - 09:01, 21 January 2021
- (Luc, 1 min) ==Point 1: 2017==3 KB (409 words) - 18:12, 1 December 2016
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==3 KB (408 words) - 18:45, 8 June 2022
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==2 KB (318 words) - 18:41, 22 September 2021
- '''Point 0''': public minutes <br>(RA, 1 min)<br>695 bytes (100 words) - 11:17, 20 July 2021
- 1) This fabulous location, by the Crochy metro stop, even, is unfortunately a ''1) Cet emplacement fabuleux, près de l'arrêt de métro Crochy, même, est m2 KB (266 words) - 15:53, 26 December 2021
- ::1) What's inside should be labelled with your name. ::1) Don't go above 80rpm with the shaking module (It's not the coolest incubat2 KB (405 words) - 12:04, 7 June 2015
- 1) [https://doi.org/10.12688/f1000research.12564.2 BeerDeCoded] <br>1,003 bytes (119 words) - 12:31, 25 September 2023
- - Ammonium concentration = 1.5 mgN/l == Day 1 - 13/08/2015 - 16h ==6 KB (868 words) - 10:27, 4 January 2016
- ::1) Never point it towards somebody.732 bytes (108 words) - 14:02, 7 June 2015
- (Vanessa, 1 min) (Vanessa, 1 min)5 KB (837 words) - 09:22, 26 May 2017
- (Vanessa, 1 min) (Vanessa, 1 min)6 KB (847 words) - 08:17, 8 March 2017
- (Luc, 1 min) (Luc, 1 min)5 KB (860 words) - 14:51, 8 February 2017
- '''Point 0''': public minutes <br>(RA, 1 min)<br> * Coding pour tous avec Jean H, mercredi 1 septembre.3 KB (436 words) - 11:59, 30 July 2021
- Speed is 9600 Baud (1 Baud = 1 bit per sec) Step 1. Tell pin to be GPIO2 <br>5 KB (899 words) - 15:25, 10 September 2016
- == Design 1 (improved) == [[File:Design1 07092018.jpg|thumb|upright=1|Design 1 (improved)]]8 KB (1,470 words) - 12:31, 7 September 2018
- Set somewhere dark, still, at 21-24 C for 1 to 4 weeks, until a ½ cm thick SCOBY has formed. It takes 1 to 4 weeks for your SCOBY to develop.2 KB (390 words) - 20:47, 2 October 2023
- (Rachel, 1 min) (Rachel, 1 min)5 KB (775 words) - 08:49, 10 August 2018
- ::1) Plug the power unit, control that each block is correctly into place. <br> ...next screen just confirms that you will run the Yann_STD protocol on block 1. Push Proceed button. Use heated lid? Say _YES. The heated lid prevents eva2 KB (351 words) - 07:20, 20 July 2015
- ::1) Do not leave any heating operation unattended. ::1) Do not use without the thermometer feedback mechanism. (make sure it is co4 KB (578 words) - 10:29, 7 June 2015
- '''Darty Monkeys: Biofilia Night #1''' *1 teaspoon of sugar4 KB (742 words) - 22:06, 19 April 2016
- 1, avec 100ul de culture (pleinement couverte) ...ion ont été appliquées : eau de Javel à pleine puissance pour la plaque 1, 1/10 d'eau de Javel dans de l'eau pour la plaque 2, et de l'eau uniquement po7 KB (1,160 words) - 07:58, 1 December 2023
- '''Agenda of Crowdfunding 1 Meeting''' (Rachel, 1 min)4 KB (689 words) - 18:18, 26 July 2017
- ::1) Always wear gloves cleaned with alcohol before working the the hood.850 bytes (128 words) - 19:12, 8 July 2015
- :1) Do not weight more than 120 grams with this scale :1) Do not weight more than 180 grams with this scale2 KB (387 words) - 09:41, 7 June 2015
- '''Point 0''': public minutes <br>(RA, 1 min)<br> * Corona Detective: 1) just at 63 degrees seems just fine (also in hands of colleague at UPenn)!2 KB (348 words) - 15:39, 22 July 2021
- 1) une introduction aux principes de base de la spectroscopie.<br>996 bytes (129 words) - 10:36, 27 November 2019
- ...For a structured summary, please refer to the [[Nitrification in Aquarium 1 (Report)|report]] of the experiment. We started the nitrifyers culture by mixing 2.5 l of pond water (including 1 l of water from the bottom of the pond + soil) with tap water, to reach a t12 KB (1,914 words) - 10:26, 4 January 2016
- *1 550nm dichroic mirror, 25x16mm (GFP) Mfr: Comar; Part No. 550 1Y 116 *1 490nm excitation filter, 25x16mm (GFP) Mfr: Comar; Part No. 495 1K 1164 KB (614 words) - 15:37, 2 December 2022
- == Phase 1: Recon == Massive pickup will be done during 1 day. <br>7 KB (1,161 words) - 11:37, 21 June 2016
- * Ammonium concentration = 1.5 mgN/l == Day 1 - 13/08/2015 - 16h ==5 KB (759 words) - 10:27, 4 January 2016
- (Vanessa, 1 min) (Rachel, 1 min)6 KB (920 words) - 10:43, 10 June 2017
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==4 KB (624 words) - 18:47, 8 June 2022
- ...veral building blocks for you proteins, give details on the templates=temp 1: ypp1: contains the pET-51b(+) vector, ypp2: contains the ...3 KB (177 words) - 09:05, 10 February 2016
- (Rachel, 1 min) ==Point 1: Michel H comme Trésorier==4 KB (597 words) - 08:22, 9 August 2020
- ...d'informations, vous pouvez consulter notre article évalué par des pairs (1), et vous trouverez de plus amples informations sur les résultats surprena 1) <nowiki>https://doi.org/10.1002/2688-8319.12094</nowiki>4 KB (640 words) - 12:19, 2 September 2023
- ...[https://us04web.zoom.us/j/72462608438?pwd=TvLOA40iYQ66tcZlqtutetqif12IIV.1 via zoom])<br> (Rachel, 1 min)4 KB (584 words) - 19:29, 10 January 2024
- * 10h30 Atelier BeeMoS (voir 1 ci-dessous) 1) Voici le [https://www.eventbrite.com/e/beemos-workshop-tickets-737203485475 KB (768 words) - 14:50, 31 October 2019
- ==1. Evacuate area==3 KB (523 words) - 06:11, 26 September 2017
- ...“Nitrification in Aquarium” (NA) experiments ([[Nitrification in Aquarium 1 (Report)|NA1]], [[Nitrification in Aquarium 2 (Report)|NA2]] & [[Nitrificat Reports for [[Nitrification in Aquarium 1 (Report)|NA1]], [[Nitrification in Aquarium 2 (Report)|NA2]] and [[Nitrific6 KB (989 words) - 13:05, 5 January 2016
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==3 KB (495 words) - 14:37, 28 November 2021
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==3 KB (504 words) - 19:47, 15 December 2021
- * Ammonium concentration = 1.5 mgN/l ...d to a satisfying ammonium concentration while [[Nitrification in Aquarium 1 (Report)|NA1]] and [[Nitrification in Aquarium 3 (Report)|NA3]] did not.4 KB (663 words) - 10:16, 4 January 2016
- 1) dry down some cheek cells on a slide, to fix with EtOH1 KB (197 words) - 13:19, 19 May 2017
- ::1) Just don't drop them and suck highly concentrated acid or basic solutions.1 KB (167 words) - 20:43, 8 July 2015
- ...). Allow to infuse for 5 minutes and add 1/2 cup sugar, glucose, fructose (1/2 cup agave, etc). Allow to cool to room temperature and add 100mL of a pre have 1/4 scoby for each and 1/2 to big jar with more fresh sweet tea to incubator...4 KB (705 words) - 20:50, 2 October 2023
- Page 1 : Aperçu général. Notre kit d’échantillonnage est formé d’une cartouche standard (Figure 1) faite pour la7 KB (1,157 words) - 13:50, 10 May 2024
- ...m https://us04web.zoom.us/j/76497668547?pwd=b0JhUofBbotUaNEvBbYX1PFaRrSsbf.1 )<br> (Rachel, 1 min)4 KB (558 words) - 11:36, 5 September 2023
- (Rachel, 1 min) ==Point 1: Comunication==3 KB (527 words) - 18:53, 5 July 2023
- (Rachel, 1 min) (Rachel, 1 min)5 KB (794 words) - 20:59, 23 January 2019
- (Vanessa, 1 min) (Vanessa, 1 min)7 KB (1,108 words) - 08:55, 11 March 2017
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==4 KB (570 words) - 18:50, 27 October 2021
- Bacterial growth is affected by (1) temperature, (2) nutrient availability, (3) water supply, (4) oxygen suppl ...e availability of water for bacterial growth. Distilled water has an AW of 1. Addition of solute, e.g. salt, reduces the availability of water to the ce11 KB (1,740 words) - 10:20, 27 October 2020
- (Rachel as President, 1 min) =Point 1: Lab visit=5 KB (849 words) - 11:38, 13 June 2019
- ...férine)." -[http://bioluminescence-rocroy.e-monsite.com/pages/introduction-1.html ''la bioluminescence''] ...tp://bioluminescence-rocroy.e-monsite.com/pages/la-bioluminescence-recreee/1-la-chimioluminescence.html ''la bioluminescence'']5 KB (787 words) - 08:45, 3 March 2015
- Point 0: public minutes (Rachel, 1 min) == Point 1: Rôles comité ==4 KB (658 words) - 20:42, 27 March 2024
- 1.-fill the bottom with water till reach the 1st level/grid on the bottom. 4.-make sure you put 125°C and 1,5T.7 KB (1,020 words) - 09:29, 8 March 2018
- Here is the [https://prezi.com/p/wsgict0-och6/?present=1 prezi around our recent work with these], used for the Biofest to help laun ...o fill them, using 20l (2 buckets of 10l) of sawdust (without resin), 10l (1 bucket of 10l) of straw, 3l (3 pitchers of 1l) coffee grinds (source from c5 KB (769 words) - 16:27, 9 November 2023
- ...i>https://us04web.zoom.us/j/72890258018?pwd=wahX5MjhLt5elTHdoz5xFNb3FaExan.1</nowiki> Point 0: public minutes (Rachel, 1 min)5 KB (811 words) - 18:25, 4 October 2023
- (Rachel, 1 min) ==Point 1: Finances & Utilité Publique ==5 KB (732 words) - 16:11, 27 January 2022
- ...eriment. For more details, please refer to the [[Nitrification in Aquarium 1 (Lab Journal)|detailed lab journal]] of this experiment. ...fyers culture on July 22nd, 2015, by mixing 2.5 l of pond water (including 1 l of water from the bottom of the pond + soil) with tap water, to reach a t6 KB (1,025 words) - 13:08, 7 March 2017
- The gel prepared was 20 mL of 1% agarose in 1x TAE buffer. It was prepared by dissolving 0.2g agarose in 2 ...Pierson's) was used for these test digests, and the further lanes on this 1% Agarose mini-gel were:4 KB (538 words) - 10:15, 21 November 2017
- Bacterial growth is affected by (1) temperature, (2) nutrient availability, (3) water supply, (4) oxygen suppl ...e availability of water for bacterial growth. Distilled water has an AW of 1. Addition of solute, e.g. salt, reduces the availability of water to the ce10 KB (1,584 words) - 14:10, 20 October 2018
- (Rachel, 1 min) =Point 1: Getting tax free status - public value institution=5 KB (687 words) - 15:21, 20 August 2019
- * Robot 1:2 KB (235 words) - 15:18, 16 March 2016
- ...[https://us04web.zoom.us/j/71426982548?pwd=C2AdB39PZIM4xCx54jdM7HOUxTNtnn.1 via zoom])<br> (Rachel, 1 min)5 KB (732 words) - 09:14, 9 January 2024
- 1) isolate cells in saline solution (0.9% NaCl in water) after gentle toothbr 3) embed cells in 1% low melting point agarose (made up in standard saline solution)7 KB (1,096 words) - 11:27, 16 January 2021
- ::1) Never sonicate empty. You can use normal tap water but nothing else than w1 KB (232 words) - 19:58, 8 July 2015
- ...ed with large amounts of urine everyday, approximately reaching the target 1/30 volume/volume urine dilution we plan to use to feed the hydroponics wall ...n August 12th, 2015, from 15 l of the mix from [[Nitrification in Aquarium 1 (Report)|NA1]].9 KB (1,491 words) - 13:30, 3 November 2016
- (Rachel, 1 min) (Rachel, 1 min)6 KB (1,085 words) - 04:21, 28 June 2018
- 1. Développer un environnement de travail où idées, conseils et savoir- 1) develop a working environment where ideas, advice and know-how are shared3 KB (509 words) - 15:50, 2 November 2018
- 1) Turn On (behind) <br>1 KB (245 words) - 19:58, 8 July 2015
- ...m https://us04web.zoom.us/j/76497668547?pwd=b0JhUofBbotUaNEvBbYX1PFaRrSsbf.1 )<br> (Rachel, 1 min)5 KB (827 words) - 18:21, 10 May 2023
- (Luc, 1 min) ==Point 1: Actionables==7 KB (1,152 words) - 19:26, 24 October 2016
- '''Point 0''': public minutes <br>(RA, 1 min)<br> * 30 juin/1 juillet - JOGL Summit (in planning - track ideas welcome - join jogl slack3 KB (514 words) - 06:17, 7 April 2022
- (Rachel, 1 min) ==Point 1: Assémblée générale==7 KB (1,036 words) - 13:03, 1 March 2023
- (Rachel, 1 min) ==Point 1: Assémblée général==4 KB (659 words) - 22:57, 18 January 2023
- These validation tests were performed in the Biosafety level 1 laboratory of the Association Hackuarium. Both bacterial and nematode cultu ...with only water, the more dense (or ‘confluent’) plate was treated with a 1 in 10 dilution of bleach, while the lawn of transformed and fluorescent bac11 KB (1,780 words) - 16:24, 14 December 2023
- =Point 1: Attendance= (Rachel, 1 min)5 KB (745 words) - 11:08, 26 April 2019
- (Rachel as President, 1 min) =Point 1: Lab Logistics, Planning=5 KB (812 words) - 10:17, 9 May 2019
- 1) the big launch that plunges into the sea to the octopuses' garden and then2 KB (276 words) - 12:42, 16 September 2017
- (Rachel, 1 min) ==Point 1: Demande Loterie Romande (réponse attendu avant fin de sept?) ==5 KB (811 words) - 14:13, 26 September 2022
- ...uarium we have two centrifuge: A table one used to centrifuge solutions in 1.5ml aliquots and a large one to centrifuge 50ml Falcon Tubes. ::<li> The "MAIN CAPACITOR FAILURE" can be solved by 1) Unplugging the centrifuge 2) Opening the front panel 3) Switching on the f2 KB (275 words) - 17:29, 25 November 2015
- ...[https://www.admin.ch/opc/fr/classified-compilation/19070042/index.html#id-1-2-2 articles 60 et suivants du Code Civil suisse]."<br> 1. L'Association a pour but de :5 KB (798 words) - 09:42, 21 December 2021
- (Rachel, 1 min) (Rachel, 1 min)8 KB (1,393 words) - 17:30, 12 July 2017
- (Luc, 1 min) ==Point 1: Projects updates==6 KB (993 words) - 10:43, 9 August 2016
- (Rachel, 1 min) =Point 1: Transition to New Board=9 KB (1,392 words) - 11:14, 26 April 2019
- Heat blocks are used to defrost, incubate and heat-up 1.5ml aliquots. ::A) Holding vials for 1.5ml aliquots2 KB (288 words) - 21:49, 5 October 2015
- [https://drive.google.com/file/d/1-A7p_NdnTDXJRGmfbwMutCkFRnTKDjuZ/view?usp=sharing 3 Points de Statuts à mod votation 1. ok ? (à la place de '' envisage la production d'un bulletin'')<br>4 KB (658 words) - 12:31, 3 October 2020
- (Rachel, 1 min) =Point 1: Website updates=5 KB (684 words) - 18:06, 21 August 2019
- (''Fixation facultative avec du méthanol: acide acétique 3:1''). ...vous pouvez juste verser une goutte sur la lame. Laisser colorer au moins 1 min puis rincer avec des gouttes d'eau, en recueillant le liquide de déche6 KB (974 words) - 10:17, 28 February 2023
- ...m https://us04web.zoom.us/j/79585851240?pwd=FGXLaA35f4KCu7BarEr2qS5gf3mvmG.1 )<br> (Rachel, 1 min)6 KB (928 words) - 19:50, 12 April 2023
- (Rachel, 1 min)<br> (Rachel, 1 min)<br>11 KB (1,854 words) - 15:51, 25 May 2018
- (Luc, 1 min) ==Point 1: Projects updates==8 KB (1,230 words) - 10:45, 9 August 2016
- (Rachel, 1 min) (Rachel, 1 min)10 KB (1,641 words) - 16:38, 17 August 2018
- 1 microgrants contact point for the community (@ana at the moment).<br>2 KB (289 words) - 12:25, 10 March 2017
- (Rachel, 1 min) ==Point 1: Demande Lotterie Romande (délai 15 juillet) ==6 KB (1,002 words) - 18:25, 13 July 2022
- (Rachel, 1 min) ==Point 1: Biosécurité pour notre P1==7 KB (1,068 words) - 12:32, 12 September 2023
- =T(t)erraforming: Alkaline Experiments #1, 2018= ...e table which lists the amount of solute (solid NaOH) that is used to make 1 L of base solution.9 KB (1,358 words) - 17:15, 24 January 2018
- ...were present on the ingredients and in the brewing environment. There are 1,000+ yeast varieties used for brewing and 200+ hops species, each one beari * July 18, 2015 [[DNA_Party_workchoppe_vol.1|First test of the DNA Workchoppe]] at Hackuarium9 KB (1,332 words) - 10:28, 4 March 2018
- (Rachel, 1 min) (Luc, 1 min)10 KB (1,564 words) - 09:13, 19 January 2018
- 1.- We will submerge organic baby spinach leaves or any "fleshy" leaves such2 KB (365 words) - 10:44, 14 June 2022
- (Luc, 1 min) ==Point 1==9 KB (1,374 words) - 10:45, 9 August 2016
- (Luc, 1 min) ==Point 1: Projects updates==8 KB (1,257 words) - 10:44, 9 August 2016
- (Rachel, 1 min) ==Point 1: Demandes de financement ==7 KB (1,075 words) - 11:37, 15 December 2022
- Point 0: public minutes (Esther et Dinesh, 1 min) ==Point 1: Médias et difusion (actuel point 4 de réunion)==10 KB (1,638 words) - 15:45, 2 May 2024
- (Rachel, 1 min) =Point 1: Finance=6 KB (917 words) - 11:45, 20 November 2019
- (Rachel, 1 min) ==Point 1: Biosécurité - documentation et analyses de risques ==7 KB (1,157 words) - 13:12, 16 November 2023
- ''(optional fix with methanol:acetic acid 3:1)'' '''Figure 1''' shows one example cheek cell containing a micronucleus, smeared, fixed a6 KB (961 words) - 16:02, 19 June 2023
- CACIB to provide a great part of funds (0.8M of 1.2M) needed for the upgrade of the building. Inartis wants to raise 50-100K *1 Post on newsletter6 KB (909 words) - 15:21, 16 May 2017
- (Rachel, 1 min)<br> (Rachel, 1 min)<br>11 KB (1,787 words) - 12:19, 12 May 2018
- ==Point 0.1: public minutes== (Luc, 1 min)10 KB (1,611 words) - 07:21, 20 September 2016
- ...[https://us04web.zoom.us/j/78908217604?pwd=eJvHJMzaAheb9GSsgQUBtTa8GAlifG.1 le lien zoom] pour l'assemblée générale ce soir a 19.45 (avec le 15min v (RA, 1 min)9 KB (1,314 words) - 14:54, 10 April 2023
- ...e validation ont été réalisés dans le laboratoire de biosécurité de niveau 1 de l'Association Hackuarium. Les cultures de bactéries et de nématodes on ...dense (ou "confluente") a été traitée avec une dilution d'eau de Javel de 1 pour 10, tandis que la pelouse de bactéries transformées et fluorescentes14 KB (2,322 words) - 16:22, 14 December 2023
- (Rachel, 1 min)<br> (Rachel, 1 min)<br>11 KB (1,851 words) - 08:51, 13 October 2017
- * 1 g NaCl2 KB (413 words) - 15:47, 14 November 2015
- 1) the big launch that plunges into the sea to the octopuses' garden and then2 KB (399 words) - 17:53, 27 September 2017
- |Food and Drinks || || style="text-align:right;" | 1,015.5 || ...position itself according to the needs and vision of its community. During 1 hour, we will discuss the philosophy, the role and the format of the associ8 KB (1,160 words) - 00:02, 9 February 2017
- 1) Check that it is plugged (behind it)2 KB (438 words) - 09:41, 7 June 2015
- (Rachel, 1 min) ==Point 1: Crowdfunding==11 KB (1,803 words) - 10:10, 8 December 2017
- (Rachel, 1 min) ==Point 1: Horizon 2020 application about nature-based solutions==10 KB (1,553 words) - 10:37, 6 March 2018
- ...ne side, with a 'pro' lab space on the other, and a shared biosafety level 1 laboratory in between. Social area was included in this design, but was qui3 KB (514 words) - 17:29, 1 September 2020
- (RA, 1 min) 1 Project is developed, ideally with transdisciplinary team, and presented i7 KB (1,137 words) - 13:43, 11 March 2021
- (RA, 1 min) ''1. Le projet est développé, idéalement avec une équipe transdisciplinaire10 KB (1,490 words) - 14:21, 22 March 2022
- (RA, 1 min)3 KB (388 words) - 12:30, 11 March 2024
- (Rachel, 1 min) ==Point 1: Demandes de financement ==9 KB (1,353 words) - 11:09, 5 December 2022
- 1) Hackpad3 KB (426 words) - 16:19, 6 September 2015
- |1 kg The mycelium colonized the surface and grew about 1.5 cm thick as in the pictures. After four days I sprayed water on it to kee6 KB (1,060 words) - 16:00, 14 June 2023
- *PROSTAGLANDIN H2 SYNTHASE-1 COMPLEX WITH FLURBIPROFEN (aka COX1 with inhibitor) (ref PDB: 1CQE) ...X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1.6 KB (946 words) - 15:27, 6 January 2016
- La plateforme «Experiment» a déjà dépassé les 1 500 000 $ de financement collecté pour diverses recherches. Les scientifiq The platform, Experiment, has already surpassed $1,500,000 in total funding raised. Scientists using the platform have been fe7 KB (1,119 words) - 12:06, 24 April 2023
- * Results slide for beers ---> One single slide with 1. parameters 2. mathematical method 3. output (PCA of beers) To be done at the end of the day: "keep in touch" UC + Hackuarium part : 1 or 2 links max providing:8 KB (1,276 words) - 13:07, 1 June 2017
- (Rachel&Vanessa, 1 min) ==Point 1: Crowdfunding==12 KB (1,977 words) - 16:28, 2 November 2017
- ...eu peuplé et le milieu stérile, est permis. En outre, un volume maximal de 1 L par tampon est autorisé. Il est strictement interdit d'utiliser des acid 1. Informez vos collaborateurs de vos expériences en cours.12 KB (1,896 words) - 10:42, 2 May 2024
- This [https://communitybio.pubpub.org/pub/m255th2q/release/1 community lab biosafety manual] is recommended... ...ing, one of which, with restricted access, is dedicated to Biosafety Level 1 (P1) experiments, using only organisms that do not normally cause disease.8 KB (1,320 words) - 09:50, 19 November 2023
- ...2–4 in metazoans), metazoans require additional proteins for NMD (e.g. SMG-1, –5, and −6). Additionally, ''Saccharomyces cerevisiae'' NMD is thought ...small>another gene mutant, [https://www.nature.com/articles/nmeth.1463 SID-1], could still be tried for the RNAi feeding experiment given the results se12 KB (1,816 words) - 07:54, 1 April 2024
- ...*10^12 en 1.6*10^12 par exemple. Il est aussi possible de noter cela comme 1.6e+12.<br><br> ...n calcul le nombre effectif de levures en multipliant la concentration par 1*10^5 ml.24 KB (4,152 words) - 13:25, 24 March 2016
- ...ing, one of which, with restricted access, is dedicated to Biosafety Level 1 (P1) experiments, using only organisms that do not normally cause disease. To ensure that Biosafety Level 1 (P1) work is carried out safely, and that pathogens or GMOs are never relea8 KB (1,338 words) - 16:30, 14 December 2023
- 1) put the plants of the two groups A and B in the same conditions (for sun a4 KB (765 words) - 11:33, 17 June 2020
- (Vanessa, 1 min) (Rachel, 1 min)8 KB (1,360 words) - 12:52, 2 October 2017
- 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg *<span style="color:blue">Insert 1:</span>10 KB (775 words) - 21:04, 29 August 2016
- 1. Alert your collaborators.<br> ...before starting an experiment which may be classified as containing class 1 organisms, the following procedure should be followed before and after the10 KB (1,727 words) - 09:12, 2 May 2024
- Tickets (2 for 1, to Do It Together!) [https://www.eventbrite.com/e/workshop-open-sourcing-d4 KB (611 words) - 12:40, 27 April 2018
- ...http://item.taobao.com/item.htm?spm=a230r.1.14.39.FcQxGy&id=41232920060&ns=1&abbucket=2#detail link] || 280nm , 0.5 - 30. mW |'''Ledwv''' || - - - || [http://www.ledwv.com/uv/uvc-leds-c-31.html?page=1&sort=3a link]||19 KB (3,043 words) - 16:01, 25 January 2016
- ===1) Rester, Payer le loyer comme demandé par Inartis=== Proposal 1: Pour: 0, Contre: 20, Abstention: 1 Rejetée<br>21 KB (3,534 words) - 09:11, 4 December 2018
- (Luc, 1 min) ==Point 1: Project Updates==15 KB (2,422 words) - 05:41, 19 August 2016
- Item 1 (removed 24Apr23) <small>1) Both types of biosafety must be taken into account: protecting people and19 KB (3,088 words) - 14:00, 10 May 2024
- ...eux peut-etre baisser le nombre de compo en mettant r4 a 1.5 kOhm et c4 a 1 uF ? Si tu fais un truc simple ca vaut peut-etre le coup... in english : r4 KB (688 words) - 16:31, 7 December 2014
- ...lly functional at the old Hackuarium site in Renens between 1 November and 1 September 2018. ...iagnostics.<br><br>Work towards making a Hackuarium lab for biosafey level 1 experimentation began very early on, after the founding of Hackuarium.17 KB (2,867 words) - 10:31, 21 December 2023
- ::1. How high is (too) high ? there is no real answer we have to make replica p '''1.Les tout premiers pas'''12 KB (1,873 words) - 15:28, 12 March 2018
- 1. '''Check-in (circle)''' within 1 week:<br>11 KB (1,655 words) - 16:48, 7 June 2017
- '''1. Introduction'''5 KB (785 words) - 08:32, 16 January 2024
- 1) Talk with everyone about your ideas and what you would like to do. Public6 KB (989 words) - 16:46, 5 November 2023
- ...divisé en [https://drive.google.com/file/d/1O5E5Z1IxXP_4p30DNW80edsNNsXm7x-1/view?usp=sharing deux aspects de biosécurité]. Cela englobe la préventio Bien que ce [https://communitybio.pubpub.org/pub/m255th2q/release/1 manuel de biosécurité du laboratoire communautaire] soit très bien fait,11 KB (1,862 words) - 16:29, 14 December 2023
- '''Point 0''': public minutes <br>(RA, 1 min)<br>4 KB (675 words) - 16:02, 10 March 2022
- Questions such as those from 1-12 in the terms of reference. 1. Are these technologies converging in a powerful way with regard to individ13 KB (2,065 words) - 11:34, 4 February 2019
- 1. Arduino IDE isntallation of v1.0.56 KB (867 words) - 13:20, 6 December 2016
- ...e Gebert Rüf Foundation. He said the 3 key things for the campaign are to 1) figure out the realistic sum to aim for, 2) the actual way to run the camp5 KB (894 words) - 05:48, 7 July 2017
- '''Point 0''': public minutes <br>(RA, 1 min)<br>5 KB (746 words) - 07:01, 20 May 2021
- ...ale, pour [https://drive.google.com/file/d/1O5E5Z1IxXP_4p30DNW80edsNNsXm7x-1/view?usp=sharing les deux types de biosécurité] - pour éviter toute fuit Ce [https://communitybio.pubpub.org/pub/m255th2q/release/1 manuel de biosécurité du laboratoire communautaire] (EN) est excellent...11 KB (1,845 words) - 10:12, 19 November 2023
- ...era dans un premier temps installé sur le parking du Impact Hub Geneva, au 1 Rue Fendt, juste derrière la gare Cornavin.5 KB (827 words) - 19:43, 3 November 2015
- (Rachel, 1 min) =Point 1: Website updates=9 KB (1,442 words) - 10:27, 8 October 2019
- 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg *<span style="color:blue">Insert 1:</span>12 KB (1,004 words) - 21:43, 29 August 2016
- ...vation of possible algal content is probably correct (photomicrographs #’s 1 and 3 illustrate this best).''<br /> ...) - when the micrometer is seen, the scale should be about 5 microns per 0.1...6 KB (1,047 words) - 09:10, 24 March 2022
- ITS 1 5'TCCGTAGGTGAACCTTGCGG and8 KB (941 words) - 12:04, 12 February 2023
- === Phase 1 === What's new compared to #1: getting the comets to show up with a non-fluorescent staining protocol (i21 KB (3,322 words) - 06:26, 13 May 2024
- ...vities (in particular, selection of clones for the HTGAA to begin) will be 1 November 2017. Biological safety level 1 lab (P1), biosafety officer (BSO), standard operating procedure (SOP)...35 KB (5,666 words) - 05:23, 3 October 2023
- * Ver datasheet (1)6 KB (901 words) - 22:04, 28 November 2019
- '''Point 0''': public minutes <br>(RA, 1 min)<br>5 KB (776 words) - 13:32, 24 June 2021
- 1) [https://doi.org/10.12688/f1000research.12564.2 BeerDeCoded] File:Fomes fleur 1.JPG|pour #mycelia4bees - ''Fomes fomentarius'' sur scie de bois24 KB (2,954 words) - 13:19, 14 May 2024
- '''Point 0: public minutes''' (RA, 1 min) ''1. Le projet est développé, idéalement avec une équipe transdisciplinaire11 KB (1,735 words) - 15:11, 13 March 2024
- ...Workshop_Makerspaces_Underground_meets_the_Upperground&action=edit&redlink=1 Notes and Results of the Workshop by Clément Renaud here ]'''<br> 1. Do we agree on the '''Motivations'''?<br>7 KB (1,035 words) - 15:45, 12 June 2017
- '''Point 0''': public minutes <br>(RA, 1 min)<br>5 KB (848 words) - 11:17, 9 March 2022
- ...mponents come for free, of course. Even the 140X borosilicate lenses were 1 USD each (including shipping, at least), for the simplest bright field vers8 KB (1,315 words) - 14:46, 20 September 2023
- ## Dilution factor (between 1:10-1:50) It can then serve in 1° for us to:14 KB (2,132 words) - 11:36, 28 December 2015
- 20:15h. Discussion part 1 (20 min) “Devenir Alien”<br>7 KB (1,004 words) - 19:20, 17 March 2018
- ...de contracter ou propager Covid-19, la maladie causée par SARS CoV-2: <br> 1) Lavez-vous les mains, surtout avant de toucher votre visage. <br> 2) Porte 1) Cet emplacement sympa, près de la station de métro Crochy, est malheureu14 KB (2,166 words) - 20:21, 16 December 2021
- 1 receive antenna: Conductive thread or metal wires and 2,2 Mega Ohm resistan ...osed of an Arduino UNO, 2 x 2 pairs of cables (1 pair for the joystick and 1 pair for the electrodes). The joystick was the [http://www.play-zone.ch/en/27 KB (4,035 words) - 16:17, 5 October 2022
- ===SECTION 1: Consider how the objects you design interacts with local environments=== ...nition. The presentation focused on 3 main ways that nature achieves that: 1) creating different functions by modifying the form, as opposed to us human50 KB (7,724 words) - 05:48, 1 September 2020
- ...ting or spreading around Covid-19, the disease caused by'' SARS CoV-2:<br> 1) Wash hands, especially before you touch your face. <br>2) Wear a mask when TO NOTE: <br>1) This fabulous [https://goo.gl/maps/R9i8bf8dHBkAJePJ6 location], by the Cro35 KB (5,296 words) - 13:05, 21 March 2022
- ...professional curiosity we have decided to initiate a limited CBEM project (1) (2) .<br> ...ontainer with the addition of the quantity of sample added to the media. A 1-5ml of sample water will be mixed into the provided gel media solution, pla29 KB (4,227 words) - 14:46, 10 May 2023
- File:Controls fromvalid.jpeg|controls : river water and 1/100 dilution (top); tap water (below)8 KB (1,245 words) - 07:57, 31 January 2023
- <li> Du café est disponible. Chaque capsule coûte 1.- qui doit être déposé dans la tasse disposée à coté de la machine.8 KB (1,349 words) - 13:15, 21 March 2022
- Our biology laboratory, certified at biosafety level 1 (BSL1 or P1), gives us the right to perform DNA cloning experiments and use ...p ORIF for a special event on biohacking and innovation. We have also had: 1) students who carried out experiments for their final high school projects18 KB (2,769 words) - 21:03, 17 March 2021
- ...15" "https://www.youtube.com/embed/F_Iqsg0R_fo?controls=0&autoplay=1& loop=1"></iframe></youtube>9 KB (1,400 words) - 18:03, 22 December 2021
- # Suspend 37.5g in 1 litre of distilled water. !Vauchere 121 KB (3,293 words) - 10:31, 7 June 2022
- *Methanol:Acetic Acid Solution (about 20ml of a 3:1 mix, i.e. 15ml '''methanol''' + 5ml of '''glacial acetic acid''') - this is10 KB (1,610 words) - 14:12, 5 December 2021
- old news: 1 October, some pods were harvested, and 15 october even more... Could this13 KB (2,134 words) - 11:17, 17 April 2024
- ...l hoping you start to make the habit to [https://wiki.hackuarium.ch/images/1/13/Flyer12mai24.png come every Wednesday]! ) '''1 juin - BBQ du coop (pour vos amis et families aussi!)'''24 KB (3,839 words) - 13:10, 14 May 2024
- Notre laboratoire de biologie a été certifié de biosécurité niveau 1 (BSL1 ou P1), ce qui nous donne le droit de faire les expériences de clona ...nement spécial sur le biohacking et l'innovation. Nous avons également eu: 1) des étudiantes qui ont fait des expériences pour leur travail de maturi23 KB (3,458 words) - 18:30, 23 June 2021
- * 2024.01.10 #OH et [[Réunion du comité 10/1/2024|réunion du comité]] :<li>'''2022.01.26''' mercredi 26 janvier [[Reunion_du_comite_26/1/2022]]53 KB (7,023 words) - 07:47, 9 May 2024
- ...ttp://www.nature.com/news/open-hardware-pioneers-push-for-low-cost-lab-kit-1.19518 Nature News] on March 8. 2016. ...r Open Hardware. International Free and Open Source Software Law Review, 4(1), 41-62.19 KB (2,752 words) - 07:20, 23 May 2016
- * Daniel Hernandez +121 KB (3,124 words) - 15:44, 11 March 2018