Difference between revisions of "First results"

From Hackuarium
Jump to navigation Jump to search
Line 161: Line 161:
  
 
== Further Feedback ==
 
== Further Feedback ==
Trying to get samples amplified in the field and sending for seq was a mess...  Needs more work.
+
Trying to get samples amplified in the field (iYngvar in Italy) and sending for seq was a mess...  Eurofins did not get the DHL package even! (came back here weeks later) Needs more work.
  
 
== Recommendation + next steps ==
 
== Recommendation + next steps ==

Revision as of 18:21, 8 February 2023

Introduction

This is a part of the project Fun_with_fungi. It is about experiments related to mycelial biodiversity.

People

Contact and lead: Yngvar

Participants: Rachel, other Hackuarium members, maybe *you*?

Objective:

To see whether species determination by simple PCR then sequencing will be possible.

Yngvar found some references describing protocols with ribosomal DNA 'internal transcribed spacer' (ITS) sequences that can be used as 'bar-coding' primers for fungus, in particular, a protocol from the Kennedy Lab by L. Higgins (2012).

Unfortunately, this reference did not have the actual primer sequences in it, although it had a great overview image of the ribosomal DNA, which we reproduce roughly here:

ITS1**>...........................................................................................................................................

<18S rDNA | 1st Internal Transcribed Spacer | 5.8S rDNA | 2nd Internal Transcribed Spacer | 28S rDNA>

......................................................................................................................................................<**ITS4

To note, ribosomal genes come in big repeated clusters in most organisms, and this is the general layout of one of the standard repeats.

(We have already done similar species determination for bacteria with their 16S rDNA genes (in the context of our water quality work and other fun Hackuarium projects - like the bioluminescent bugs...)

When we got down to the sequence level, in various references, we realised that some published sequences were not correctly transcribed, or at least, the ITS1 primer was missing a T in a few of the references (even in a PCR Protocol book from Cold Spring Harbor, put out in 1990).

However, the following two primers, in the end, were also in several publications (and fit better by sequence comparisons than without the extra T), and are the ones we used:

ITS 1 5'TCCGTAGGTGAACCTTGCGG and

ITS 4 5'TCCTCCGCTTATTGATATGC

These are generally as published here (open access), thanks to Z. Haque, et al... =)

(As indicated in the schematic above, the ITS1 sequence come from within the 18S rDNA sequence, while the ITS4 is from the 28S rDNA sequence.

The first test of these primers was performed in our lab on February 3 2022, and we made an evernote protocol with detailsabout comparing fresh, freeze/thawed and simple 'touch with a toothpick' comparisons.

For one mycelia type, shiitake, all three reactions worked well, for another, only after the freeze-thaw was good, for instance.

After good PCR products are seen, it is still no guarantee of a perfect sequence, as a few differences can define the species. Generally, however, one good band would be purified with Qiagen columns and sent out for sequencing (Eurofins LightRun, or Microsynth seqs have been used over the years - also for bacteria as in our Montreux water work, with 16S primers...)

Ultimately we got sequences for all three samples, as shown below:


>BWA541_12485414_12485414

AGAATCCTAATGGGAAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTT

GATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCT

ATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTC

AACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA

ATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAA

CTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCAT

TAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTTTGGCTCT

CTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAG

CC

KP mycelia and

yes! Pleurotus eryngii

identical 627bp


>BWA542_12485421_12485421

AATTAAGATGGGCCTTTGCTAGTTTTCTAGCGAATGGTTCATTCTTTTTTACTGTGAACTGTTTTAATTTTTCAGCGTCT

GAGGAATGTCTTTTAGCCATAGGGATAGGCTACTAGAATGTTAACCGAGCTGAAAGTCAGGCTTAGGCCTGGTATCCTAT

TAATTATTTACCAAAAGAATTCAGTATTATAATTGTAACATAAGCGTAAAAAACTTATAAAACAACTTTTAACAACGGAT

CTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTC

TTTGAACGCAACTTGCGCTCAATGGTATTCCATTGAGCACGCCTGTTTCAGTATCAAAAACACCCCACATTCATAATTTT

GTTGTGAATGGAATTGAGAGTTTCGGCTTTATTGCTGAATTCTTTAAAATTATTAGGCCTGAACTATTGTTCTTTCTGCC

TGAACATTTTTTTAATATAAAGGAATGCTCTAGTAAAAAGACTATCTCTGGGGCCTCCCAAATAAATCATTCTTAAATTT

GATCTGAAATCAGGCGGGATTACCCGCTGAACTTAAGCATATCATAAGA

PB mold thing?

Mucor hiemalis?

https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/mucor-hiemalis

uncultured fungus

Beauveria bassiana

??

609bp identity

can come with parasite bug (also balloons - as seen!)


>BWA543_12485438_12485438

TCCTCCTCCGATTTCTATTCATCCACCTGTGCACTTTTTGTAGGAGTTCTTTCATCGGGTTTTTGAAGGTGCTCATTATG

AGTTACTTGAAAAGACTAGTTGACAAGGCTTCTATGTTCTTATAAACCATCGAAGTATGTTATAGAATGATCTCGTTATT

GGGACTTTATTGACCCTTTAAACTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCG

AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTCTGGTATTCCG

GAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTTTATAAGTTTTTTACTTATTAAAGC

only 381/383 identity

Lentinula edodes

and that is Shiitake!!

yay!

The objective of our next real experiment was to find out more about 'hair ice' and the fungus that helps it form

Here is the Evernote protocol we put together...

It was fun to see the hair ice (or something like it) just grow in our freezer (from a wet stick in a plastic zip bag). We still have more sticks from Yngvar's colleague. However, we got samples to amplify by PCR from a sort of goo that grew on the stick, not from the ice itself.

In the end the sequence from this culture gave Exidia thuretiana as its strongest sequence hit - with 105 bp identical

?? something close to the expected fungus Exidiopsis effusa

this still needs to be repeated.

A third objective for our experiments was to determine more about species that are not well known.

We got one from Yngvar's colleague that was predicted not to be in Genbank yet.

We also tried some wild mycomycetes cultures.

One gave very low but clean signal for a short stretch...

>FQA239_37962396_37962396

GCAATTTCTATTGTCTTGGCCTTTCTTTCCTTTTTCTTGTGAAAGGGAGGGGTAAGGAGTTTTTTCCTCTCCCCTCTCTC

ACTTCTTTTGGAGTGAGAGAGAGAGACGAGGCTAAGACACAGCTAAACAAACAACTTTTCTTACAAAAAACTCTTAACAG

TCATGTTAAAAGGATTTTTTGCCAAAAATCTTACATGTTTGAATGCTTATAGCAAACAAAACTAAGAAAATG

After sequence analysis with Blast (a workshop can be done on this), it really was amazing, something I never had happen before !!

  - just one hit and only 83% identity

We have more more to learn and do

Further Feedback

Trying to get samples amplified in the field (iYngvar in Italy) and sending for seq was a mess... Eurofins did not get the DHL package even! (came back here weeks later) Needs more work.

Recommendation + next steps

We have more more to learn and do! but the Q5 enzyme is already very expensive for our community lab!

(We need high fidelity polymerase however, or the few key base changes that might occur with ordinary Taq would not provide reliable IDs...)

Yngvar really wants to get into the metagenomics as in OpenFoodRepo DNA...

We need to figure out some way to do this again.


Categories: Work In Progress