Test by YP

From Hackuarium
Jump to: navigation, search
What is the purpose of the GMO / protein you want to create? I need a bioluminescence for a art project (buffer test: aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa)
Describe why you require lab access to achieve your goal? I will encode the Lux operon in e.coli
Which plasmid will you use? pET-51b(+)
If you want to use several building blocks for you proteins, give details on the templates temp 1: ypp1: contains the pET-51b(+) vector, ypp2: contains the ...
Give the primers you are going to use to realise your clones P1_F : TGGTAGTGAAGCAAGCGCCAGCATTATTG, tm = 66°C

Nice start: What could be needed: - big box for the cassette sequence - big box for translation - several entries for tamplate as [name] [description] - several entries for primers as [name] [sequence] [tm (melting temperature)]

Powered by LabGenius
